Gene name |
SPCC1259.13 |
Gene ID |
45/G09 |
Gene synonyms/obsolete |
chk1; rad27 |
Gene product |
serine/threonine
protein kinase; involved in DNA repair; involved in DNA damage
checkpoint; interacts physically with Ded1p |
Entry clone |
Cloned |
ORF length (unspliced) |
1756 |
ORF length (spliced) |
1491 |
Entry clone length |
1756 |
No. of intron |
6 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1259.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCAAAAATTAGATAA |
Rev primer name |
SPCC1259.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTTGTGAAACATCTGTA |
Amino acid length |
496 |
Molecular weight |
56.5 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASRLMLKLRI/LYDSLRLLAI/LTNLGHNLEL |
Localization (YFP) |
nucleus>cytosol;
cytoplasmic dots; nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |