| Gene name |
SPBC36.01c |
| Gene ID |
45/G02 |
| Gene synonyms/obsolete |
|
| Gene product |
unknown specificity;
transporter; similar to Sp SPAC11D3.05 and SPCC794.04C and
SPCC569.05C and SPBC36.03C and SPBC530.15C and SPBC36.02C and
SPBC530.02 and SPBC947.06C; tandem duplication; involved in
amine/polyamine transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1743 |
| ORF length (spliced) |
|
| Entry clone length |
1743 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC36.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAATCCTCTGTTAA |
| Rev primer name |
SPBC36.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACTGAGCAGTCATTTTA |
| Amino acid length |
580 |
| Molecular weight |
64.1 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
ambiguous
structure |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |