| Gene name |
SPBP8B7.07c |
| Gene ID |
45/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-MYND type; SET domain; histone lysine methyltransferase; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1625 |
| ORF length (spliced) |
1452 |
| Entry clone length |
1625 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1596G:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBP8B7.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGCCCCTTTGATTGC |
| Rev primer name |
SPBP8B7.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTATGTTACTAGGAAGTCT |
| Amino acid length |
483 |
| Molecular weight |
55 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSVCRLLI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |