| Gene name |
SPBC13E7.02 |
| Gene ID |
45/C09 |
| Gene synonyms/obsolete |
cwf24 |
| Gene product |
acetyltransferase;
GNAT family; complexed with Cdc5p; zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); zf-CCCH
type; no apparent orthologs (with acetyltransferase domain,
possible deletion? check sequence*) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1602 |
| ORF length (spliced) |
|
| Entry clone length |
1602 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC13E7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAAAAAAATTTAAA |
| Rev primer name |
SPBC13E7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGATTTGAAATTATATTA |
| Amino acid length |
533 |
| Molecular weight |
60.7 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
27/29/68 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |