Gene name |
SPCC1450.15 |
Gene ID |
45/B01 |
Gene synonyms/obsolete |
|
Gene product |
phosphoethanolamine
N-methyltransferase activity; involved in GPI anchor
biosynthesis; similar to human PIG-F |
Entry clone |
Cloned |
ORF length (unspliced) |
1562 |
ORF length (spliced) |
1512 |
Entry clone length |
1562 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1450.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTGTACGTTTATCAA |
Rev primer name |
SPCC1450.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGAAGAATCTCTCCAACT |
Amino acid length |
503 |
Molecular weight |
56.6 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGKAIAKELVL/LVGSLLSSLPI/LLLTFTQLTI/LTYFCALTL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |