Gene name |
SPAC24C9.15c |
Gene ID |
44/H02 |
Gene synonyms/obsolete |
spn5; mde9;
meu28 |
Gene product |
GTP-binding protein;
septin; meiotic expression upregulated; meiosis dependent
expression |
Entry clone |
Cloned |
ORF length (unspliced) |
1522 |
ORF length (spliced) |
1395 |
Entry clone length |
1522 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
595T:deletion /
596T:deletion |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC24C9.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAGCTCAAATTTGTC |
Rev primer name |
SPAC24C9.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCTAAGATGCCTGCTTTT |
Amino acid length |
464 |
Molecular weight |
53.1 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |