Gene name |
SPBC13E7.08c |
Gene ID |
44/G11 |
Gene synonyms/obsolete |
|
Gene product |
proteasome interacting
protein; involved in regulation of transcription elongation;
RNA polymerase II associated Paf1 complex |
Entry clone |
Cloned |
ORF length (unspliced) |
1480 |
ORF length (spliced) |
1290 |
Entry clone length |
1480 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC13E7.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGATTCTAAAGAAGA |
Rev primer name |
SPBC13E7.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCGCTATCGCTCTCAACA |
Amino acid length |
429 |
Molecular weight |
48.7 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
261 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |