Gene name |
SPAC2F3.16 |
Gene ID |
44/G06 |
Gene synonyms/obsolete |
|
Gene product |
zinc-finger protein;
with possiblzinc finger protein; zf-C2H2 type(; zf-C3HC4 type
(RING finger); ubiquitin ligase (E3); zinc-binding protein;
LIM domain signature; no apparent Sc ortholog |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
1464 |
ORF length (spliced) |
1278 |
Entry clone length |
1464 |
No. of intron |
3 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC2F3.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTGTCGGAGTATCT |
Rev primer name |
SPAC2F3.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATAAAACTGTGAATCCCG |
Amino acid length |
425 |
Molecular weight |
49.9 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|