Gene name |
SPBC1604.06c |
Gene ID |
44/G02 |
Gene synonyms/obsolete |
|
Gene product |
conserved
protein |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
1458 |
ORF length (spliced) |
|
Entry clone length |
1458 |
No. of intron |
0 |
Sequence status |
#Not cloned yet |
Sequence results |
#Not cloned yet |
Comments |
|
Polymerase used for cloning |
|
Fwd primer name |
SPBC1604.06c.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATAAAGGATCTCGAAAA |
Rev primer name |
SPBC1604.06c.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATCCATGATTTTTCGAGA |
Amino acid length |
485 |
Molecular weight |
55.4 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNGLFTLMI |
Localization (YFP) |
not cloned |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|