Gene name |
SPCC18B5.06 |
Gene ID |
44/D11 |
Gene synonyms/obsolete |
erf1; sup45 |
Gene product |
translation release
factor; eRF1-like protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1390 |
ORF length (spliced) |
1173 |
Entry clone length |
1390 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC18B5.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTGATTCAAAAAAA |
Rev primer name |
SPCC18B5.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTATGTTCAAAATTTTGG |
Amino acid length |
390 |
Molecular weight |
44.3 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGAIGELLI |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |