| Gene name |
SPCC4G3.07c |
| Gene ID |
44/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
transcriptional regulator; zf-PHD finger; similar to human
retinoblastoma binding protein 2; similar toSp SPAC30D11.08c
(paralog); no apparentSc ortholog; involved in transcriptional
regulation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1386 |
| ORF length (spliced) |
|
| Entry clone length |
1386 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC4G3.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAAAAGAATTTTTT |
| Rev primer name |
SPCC4G3.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAACAGTAGCACATAAA |
| Amino acid length |
461 |
| Molecular weight |
51.2 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |