Gene name |
SPAC1687.21 |
Gene ID |
43/F01 |
Gene synonyms/obsolete |
SPAC222.01 |
Gene product |
phosphoglycerate
mutase family |
Entry clone |
Cloned |
ORF length (unspliced) |
927 |
ORF length (spliced) |
630 |
Entry clone length |
927 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1687.21.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGTGTTCTTGATTCG |
Rev primer name |
SPAC1687.21.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAATTAATTTGCCAGTC |
Amino acid length |
209 |
Molecular weight |
23.6 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAQRLLPLDI |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |