| Gene name |
SPAC25B8.14 |
| Gene ID |
43/E11 |
| Gene synonyms/obsolete |
mal2 |
| Gene product |
involved in genome
stability (required); involved in chromosome segregation
(required); essential; deletion mutant results in
nondisjunction of sister chromatids; involved in chromatin
organization at the centromere (maintenance) (required);
involved in centromeric transcriptional silencing (required);
inner centomere core complex; required for correct metaphase
spindle length; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
912 |
| ORF length (spliced) |
|
| Entry clone length |
912 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC25B8.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGATGAAGAAGGCAA |
| Rev primer name |
SPAC25B8.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAACGAAGCATGACTTTCT |
| Amino acid length |
303 |
| Molecular weight |
34.5 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQINKSLTI |
| Localization (YFP) |
SPB;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |