| Gene name |
SPAC4C5.03 |
| Gene ID |
43/E08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; hypothetical protein; CTNS domain (SMART);
involved in glycosylation; PQ loop (inferred from
context) |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
909 |
| ORF length (spliced) |
|
| Entry clone length |
909 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4C5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTTTAGCACGAGCAG |
| Rev primer name |
SPAC4C5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGGGACCAGTTTCGGCT |
| Amino acid length |
302 |
| Molecular weight |
33.8 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGVFTWGLFI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |