| Gene name |
SPBC21D10.08c |
| Gene ID |
43/E05 |
| Gene synonyms/obsolete |
|
| Gene product |
sequence orphan;
hypothetical protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
884 |
| ORF length (spliced) |
834 |
| Entry clone length |
884 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC21D10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAACGTGGAACAACC |
| Rev primer name |
SPBC21D10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGCTTGTTCCACAGGTTC |
| Amino acid length |
277 |
| Molecular weight |
31.7 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |