Gene name |
SPBP8B7.31 |
Gene ID |
42/G11 |
Gene synonyms/obsolete |
|
Gene product |
magnesium dependent
phosphatase (putative) |
Entry clone |
Cloned |
ORF length (unspliced) |
667 |
ORF length (spliced) |
534 |
Entry clone length |
667 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBP8B7.31.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAAAAATATCGAATT |
Rev primer name |
SPBP8B7.31.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGAGTTTTTTTTAATTTT |
Amino acid length |
177 |
Molecular weight |
20.4 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDYTLWPLWI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |