Gene name |
SPCC645.03c |
Gene ID |
42/G08 |
Gene synonyms/obsolete |
lsa1 |
Gene product |
hypothetical protein;
possible involvement iniron-sulfur protein; involved in
iron-sulfur cluster biosynthesis; HesB-like domain; involved
in iron metabolism; involved in sulfur metabolism |
Entry clone |
Cloned |
ORF length (unspliced) |
661 |
ORF length (spliced) |
573 |
Entry clone length |
661 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC645.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGAGTTGTCTTTCGAA |
Rev primer name |
SPCC645.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAAGAGTACTAAACGAT |
Amino acid length |
190 |
Molecular weight |
21.2 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQFLRKLSL |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |