| Gene name |
SPBC119.04 |
| Gene ID |
42/B03 |
| Gene synonyms/obsolete |
mei3 |
| Gene product |
21 kD protein inducing
meiosis and sporulationinduces meiosis and sporulation;
phosphorylated by Pka1p; no apparent orthologs |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
447 |
| ORF length (spliced) |
|
| Entry clone length |
447 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC119.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTCTCAAAACACCTC |
| Rev primer name |
SPBC119.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGAGAGGTGTTGTTTACA |
| Amino acid length |
148 |
| Molecular weight |
16.4 |
| Isoelectric point (calc.) |
12 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTNELTILDL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |