Gene name |
SPCPB16A4.04c |
Gene ID |
41/H09 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; methyltransferase |
Entry clone |
Cloned |
ORF length (unspliced) |
1012 |
ORF length (spliced) |
822 |
Entry clone length |
1012 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
241A:G / 338A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCPB16A4.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCTACAGCCAAAAA |
Rev primer name |
SPCPB16A4.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTGGATTTGGAATGCGC |
Amino acid length |
273 |
Molecular weight |
31.6 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGPQFPDTLVL |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |