| Gene name |
SPCPJ732.03 |
| Gene ID |
41/D03 |
| Gene synonyms/obsolete |
meu15 |
| Gene product |
meiotic expression
upregulated; NLS; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
551 |
| ORF length (spliced) |
453 |
| Entry clone length |
551 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
84A:G / 173C:T /
535C:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCPJ732.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGAAACTTTGCCCAG |
| Rev primer name |
SPCPJ732.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACGAGATTTGAAGCATCA |
| Amino acid length |
150 |
| Molecular weight |
17.8 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |