| Gene name |
SPBC685.07c |
| Gene ID |
41/C02 |
| Gene synonyms/obsolete |
rpl2701; rpl27-1;
rpl27a |
| Gene product |
60S ribosomal protein
L27 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
455 |
| ORF length (spliced) |
411 |
| Entry clone length |
455 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
417G:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC685.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAAGATTCTCAAGCC |
| Rev primer name |
SPBC685.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAATCTCAAAGGAGTGAAG |
| Amino acid length |
136 |
| Molecular weight |
15.3 |
| Isoelectric point (calc.) |
11.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |