Gene name |
SPBC29A3.14c |
Gene ID |
41/A09 |
Gene synonyms/obsolete |
trt1 |
Gene product |
telomerase catalytic
subunit; reverse transcriptase 1 |
Entry clone |
Cloned |
ORF length (unspliced) |
3639 |
ORF length (spliced) |
2967 |
Entry clone length |
3639 |
No. of intron |
15 |
Sequence status |
Finished |
Sequence results |
727A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC29A3.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAACACCATACCCC |
Rev primer name |
SPBC29A3.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGCTATTCTTCTATGT |
Amino acid length |
988 |
Molecular weight |
116.3 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
197/196 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKDLETFLKL/LLRVVDDFLFI/LRPVLRQVLFL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |