| Gene name |
SPBC17A3.04c |
| Gene ID |
40/H09 |
| Gene synonyms/obsolete |
pi043;
SPBC17A3.04c |
| Gene product |
methionine-tRNA
ligase; involved in methionyl-tRNA aminoacylation;
methionine-tRNA ligase activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2476 |
| ORF length (spliced) |
2349 |
| Entry clone length |
2476 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17A3.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAACCTATAAAGTTCA |
| Rev primer name |
SPBC17A3.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTGATCCATTACCACCA |
| Amino acid length |
782 |
| Molecular weight |
88.8 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |