| Gene name |
SPBC32F12.04 |
| Gene ID |
40/F08 |
| Gene synonyms/obsolete |
tug1; gtb1 |
| Gene product |
tubulin gamma chain;
gamma tubulin complex; involved in G1 progression (required);
spindle assembly checkpoint component; involved in chromosome
segregation; involved in cytokinesis; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1673 |
| ORF length (spliced) |
1341 |
| Entry clone length |
1673 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
1397T:addition /
1602G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32F12.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAGAGAAATCATTAC |
| Rev primer name |
SPBC32F12.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGATAAATAATTGGGA |
| Amino acid length |
446 |
| Molecular weight |
49.9 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
395 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLALKRLTL/LDVMRRLLL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |