Gene name |
SPBC646.14c |
Gene ID |
40/E10 |
Gene synonyms/obsolete |
orc5 |
Gene product |
origin recognition
complex (subunit 5) |
Entry clone |
Cloned |
ORF length (unspliced) |
1461 |
ORF length (spliced) |
1368 |
Entry clone length |
1461 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
454T:C / 1076T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC646.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATTTGTATCAGTTGGA |
Rev primer name |
SPBC646.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCGCCAAATAACTATCG |
Amino acid length |
455 |
Molecular weight |
51.7 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
333 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSQLAQLPI |
Localization (YFP) |
nucleus |
Comments for localization |
nuclear dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |