| Gene name |
SPBC660.04c |
| Gene ID |
40/C06 |
| Gene synonyms/obsolete |
fbp1;
SPBC1198.14c |
| Gene product |
fructose-1,6-bisphosphatase; glucose repression of
transcription occurs by a cAMP signaling pathway; glucose
repression of transcription is partially regulated by
adenylate cyclase activation by a G protein alpha subunit
encoded by gpa2; transcriptional regulators include two
redundant Tup1p-like corepressors and the CCAAT binding factor
activation complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1044 |
| ORF length (spliced) |
|
| Entry clone length |
1044 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
677T:C / 723T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC660.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAAAGATCTCGACGA |
| Rev primer name |
SPBC660.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTATGAAATTAATATAT |
| Amino acid length |
347 |
| Molecular weight |
38.5 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |