| Gene name |
SPAC688.13 |
| Gene ID |
40/C02 |
| Gene synonyms/obsolete |
scn1 |
| Gene product |
interacts physically
with Cut9p; TatD DNase family |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
1008 |
| ORF length (spliced) |
|
| Entry clone length |
1008 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
Mixture from (-5) /
583A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC688.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCTATCATTGACGC |
| Rev primer name |
SPAC688.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTACTTTCAAAAATGCT |
| Amino acid length |
335 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |