| Gene name |
SPBC21B10.05c |
| Gene ID |
40/B09 |
| Gene synonyms/obsolete |
pop3; wat1 |
| Gene product |
WD repeat protein;
involved in peroxisomal targeting; involved in genome
stability; involved in microtubule cytoskeleton organization
and biogenesis; involved in mRNA processing; TOR signaling
pathway |
| Entry clone |
Cloned |
| ORF length (unspliced) |
945 |
| ORF length (spliced) |
|
| Entry clone length |
945 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21B10.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGTACAGTATCCACC |
| Rev primer name |
SPBC21B10.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTTGGTAGTCATTAAGA |
| Amino acid length |
314 |
| Molecular weight |
35.1 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |