| Gene name |
SPBC31F10.06c |
| Gene ID |
40/B05 |
| Gene synonyms/obsolete |
sar1 |
| Gene product |
GTP-binding protein;
ADP-ribosylation factor; involved in intracellular protein
transport; involved in secretory pathway (required); involved
in cell cycle progression (required); possibly as a result of
nuclear envelope defects |
| Entry clone |
Cloned |
| ORF length (unspliced) |
879 |
| ORF length (spliced) |
573 |
| Entry clone length |
879 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
393A:G / 451A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31F10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTATCATTAACTGGTT |
| Rev primer name |
SPBC31F10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACGTATTGAGCAAGCCAC |
| Amino acid length |
190 |
| Molecular weight |
21.2 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LARVPFLIL |
| Localization (YFP) |
ER; cytoplasmic
dots |
| Comments for localization |
abnormal shape of ER
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |