| Gene name |
SPBC4F6.18c |
| Gene ID |
39/H12 |
| Gene synonyms/obsolete |
arf1 |
| Gene product |
GTP-binding protein
that functions as an allosteric activator of the cholera toxin
catalytic subunit, an ADP- ribosyltransferase; Involved in
protein trafficking; may modulate vesicle budding and
uncoating within the Golgi apparatus; Belongs to the small
GTPase superfamily; Arf family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
611 |
| ORF length (spliced) |
543 |
| Entry clone length |
611 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4F6.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTTGAGTATTAGCAA |
| Rev primer name |
SPBC4F6.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGATTCTTAAGATTGGTA |
| Amino acid length |
180 |
| Molecular weight |
20.6 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |