Gene name |
SPAC57A7.11 |
Gene ID |
39/D06 |
Gene synonyms/obsolete |
mip1 |
Gene product |
putative guanine
nucleotide binding protein WD repeat protein; facilitates
function of the meiotic regulator Mei2p |
Entry clone |
Cloned# |
ORF length (unspliced) |
3942 |
ORF length (spliced) |
|
Entry clone length |
3942 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC57A7.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATAGAATTAGTGA |
Rev primer name |
SPAC57A7.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACTCGTTCGGCGAATCC |
Amino acid length |
1313 |
Molecular weight |
148.5 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQNPFPNKLNL/LILLSKFLDL/LTRSLKGLAL |
Localization (YFP) |
cytoplasmic dots,
especially at site of septum formation; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol)
|
Microscope used for
observation |
DeltaVision |