| Gene name |
SPCC1450.17 |
| Gene ID |
39/A11 |
| Gene synonyms/obsolete |
ste6;
SPCC1442.01 |
| Gene product |
guanine-nucleotide
releasing factor, Ste6p guanine-nucleotide releasing factor;
involved in conjugation; src (SH3) homology domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2736 |
| ORF length (spliced) |
|
| Entry clone length |
2736 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
404T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1450.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGTTTCAAACGACCGC |
| Rev primer name |
SPCC1450.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAATGCCAGAATCAATT |
| Amino acid length |
911 |
| Molecular weight |
105.1 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSNLCDLYL/LSQELEDLSL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |