| Gene name |
SPAC16E8.09 |
| Gene ID |
39/A01 |
| Gene synonyms/obsolete |
scd1; ral1 |
| Gene product |
mating and
morphogenesis protein Scd1p. guanine nucleotide exchange
factor; involved in conjugation; involved in cell polarity
(required); involved in sporulation; involved in cellular
morphogenesis; involved in endocytosis; regulates Cdc42p; GEF
for Cdc42p; non-essential; deletion results in round cells;
deletion results in mating defects; deletion can worsen the
growth defect of moe1; interacts physically with Moe1p;
interacts physically with Scd2p (effector PC domain, target
PB1 domain); involved in spindle formation; CH domain; RhoGEF;
pleckstrin homology domain; octicosapeptide repeat;
Ras1p-Scd1p-Scd2p-Cdc42p-Shk1p complex; calponin homology (CH)
domain (SMART) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2697 |
| ORF length (spliced) |
2619 |
| Entry clone length |
2697 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2616A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16E8.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCTACTTTCAGGATCG |
| Rev primer name |
SPAC16E8.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAATAAACAACAACGTGC |
| Amino acid length |
872 |
| Molecular weight |
99.1 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGLEMNLSL |
| Localization (YFP) |
nucleus>>cytosol; periphery at site of septum
formation; SPB? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |