Gene name |
SPAC22F8.05 |
Gene ID |
38/H06 |
Gene synonyms/obsolete |
|
Gene product |
alpha,alpha-trehalose-phosphate synthase; glycosyl
transferase family 20; similar to Sp SPACUNK4.16c
(paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
2676 |
ORF length (spliced) |
|
Entry clone length |
2676 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1653T:C / 1746T:C /
2258A:G / 2654T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22F8.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAGACAATTCATTTG |
Rev primer name |
SPAC22F8.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCACATAATGAGTTTAAA |
Amino acid length |
891 |
Molecular weight |
100.6 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLSMKKALTL |
Localization (YFP) |
cytosol |
Comments for localization |
bright large dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |