Gene name |
SPAC1687.11 |
Gene ID |
38/G06 |
Gene synonyms/obsolete |
pmt2 |
Gene product |
RNA methyltransferase;
potential SAM-dependent enzyme; involved in rRNA
processing |
Entry clone |
Cloned |
ORF length (unspliced) |
2647 |
ORF length (spliced) |
2409 |
Entry clone length |
2647 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
345T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1687.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAATCACAAAAAAA |
Rev primer name |
SPAC1687.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGACGACCCTTTTTAGCT |
Amino acid length |
802 |
Molecular weight |
90.9 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nucleus |
Comments for localization |
bright nuclear dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |