| Gene name |
SPCC74.02c |
| Gene ID |
38/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical
serine-rich protein; sequence orphan |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2462 |
| ORF length (spliced) |
2133 |
| Entry clone length |
2462 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC74.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAATTGGAATTCCGT |
| Rev primer name |
SPCC74.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATAGCATTCGAGTAATTT |
| Amino acid length |
710 |
| Molecular weight |
77.2 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
500 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIHLILLVL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |