| Gene name |
SPBC6B1.06c |
| Gene ID |
38/D06 |
| Gene synonyms/obsolete |
ubp14 |
| Gene product |
ubiquitin C-terminal
hydrolase activity; UBA domain; ubiquitin-binding protein
(implicated); involved in protein deubiquitination; zinc
finger protein; zf-UBP type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2397 |
| ORF length (spliced) |
2328 |
| Entry clone length |
2397 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
5C:T / 170A:G /
1266T:C / 1448T:C / 2324A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC6B1.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTGTCCGCACCTCAC |
| Rev primer name |
SPBC6B1.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTAGCCTTTCAAAAAGA |
| Amino acid length |
775 |
| Molecular weight |
86.7 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |