| Gene name |
SPBC354.05c |
| Gene ID |
38/D04 |
| Gene synonyms/obsolete |
|
| Gene product |
DNA-binding protein;
involved in transcriptional regulation; myc family; basic
helix-loop-helix (bHLH); membrane-tethered transcription
factor; no apparent Scortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2382 |
| ORF length (spliced) |
|
| Entry clone length |
2382 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
111A:G / 1030T:C /
1341T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC354.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTCCTTCCCAACACTC |
| Rev primer name |
SPBC354.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTGCAACACCAGATTCT |
| Amino acid length |
793 |
| Molecular weight |
86.8 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHSILRFLLLL/LRGKLLSELNL |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |