| Gene name |
SPAC1610.03c |
| Gene ID |
38/D02 |
| Gene synonyms/obsolete |
crp79; meu5 |
| Gene product |
RNA-binding protein;
polyadenylate binding; meiotic expression upregulated;
involved in mRNA export; rrm RNA recognition motif;
non-essential; Crp79p nuclear import depends on the Ran
system; similar to Sp SPAC343.07; no apparent Scortholog
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
2380 |
| ORF length (spliced) |
2133 |
| Entry clone length |
2380 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
433A:deletion /
1873A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1610.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAATTCAAAACTCTC |
| Rev primer name |
SPAC1610.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCTGCGTCAACTGAATA |
| Amino acid length |
710 |
| Molecular weight |
79 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGQLSGNLDI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |