| Gene name |
SPAC32A11.01 |
| Gene ID |
38/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2306 |
| ORF length (spliced) |
2163 |
| Entry clone length |
2306 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
323A:G / 462T:C /
1385G:A / 1651T:C / 1758A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC32A11.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAGAAGCATCTGTAC |
| Rev primer name |
SPAC32A11.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATTTATTTTGAATTTTA |
| Amino acid length |
720 |
| Molecular weight |
82.4 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTELASRLEL |
| Localization (YFP) |
periphery at site of
septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |