| Gene name |
SPAC222.02c |
| Gene ID |
38/B11 |
| Gene synonyms/obsolete |
SPAC1687.22c |
| Gene product |
RNA-binding protein;
pumilio family |
| Entry clone |
Cloned
(Re-cloned) |
| ORF length (unspliced) |
2303 |
| ORF length (spliced) |
2199 |
| Entry clone length |
2303 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
781G:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC222.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTACTGCTGTAAATTC |
| Rev primer name |
SPAC222.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGCATTCCTTGCTGGCC |
| Amino acid length |
732 |
| Molecular weight |
81 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |