Gene name |
SPBC2G2.06c |
Gene ID |
38/B04 |
Gene synonyms/obsolete |
apl1 |
Gene product |
adaptin; AP-2 adaptor
complex; involved in vesicle-mediated transport |
Entry clone |
Cloned |
ORF length (unspliced) |
2258 |
ORF length (spliced) |
2034 |
Entry clone length |
2258 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
637A:G / 833T:C /
1221T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2G2.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAGTAGTTCAAGTCA |
Rev primer name |
SPBC2G2.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCATTAAATGTGTTTCA |
Amino acid length |
677 |
Molecular weight |
76.5 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKLCYLYL/LKGFFDEPLEI |
Localization (YFP) |
SPB;
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |