| Gene name |
SPCC338.13 |
| Gene ID |
38/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
Golgi transport
complex; involved in intracellular protein transport; PPR
domains (inferred from context); involved in secretory
pathway; involved in ER to Golgi transport; conserved
eukaryotic protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2217 |
| ORF length (spliced) |
|
| Entry clone length |
2217 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
52T:C / 1274A:G /
1437T:C / 2027T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC338.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACATATCCATCAATGA |
| Rev primer name |
SPCC338.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTCACCTTGAACATTC |
| Amino acid length |
738 |
| Molecular weight |
85.3 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIKNMAERLVL |
| Localization (YFP) |
cytoplasmic dots at
cell tip; periphery at site of septum formation; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |