| Gene name |
SPAC3A11.08 |
| Gene ID |
37/H12 |
| Gene synonyms/obsolete |
pcu4; Cul-4 |
| Gene product |
cullin family;
regulator of ribonuceotide reductase localization; copurifies
with signalosome |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2205 |
| ORF length (spliced) |
|
| Entry clone length |
2205 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1337A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCAGAAGCAAAACG |
| Rev primer name |
SPAC3A11.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTGACATATGTATAAATA |
| Amino acid length |
734 |
| Molecular weight |
85.3 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQVVMAGLGL/LKEVFSEILDL |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |