| Gene name |
SPBC354.13 |
| Gene ID |
37/H09 |
| Gene synonyms/obsolete |
rga6 |
| Gene product |
GTPase activator;
RhoGAP domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2202 |
| ORF length (spliced) |
|
| Entry clone length |
2202 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
150A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC354.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCTTAAATCCTTCGAC |
| Rev primer name |
SPBC354.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATTTCTTCTTGTTTGAT |
| Amino acid length |
733 |
| Molecular weight |
80.7 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
239 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGIIFGPLLL/LLKINSLDI |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |