Gene name |
SPAC8C9.15c |
Gene ID |
37/H05 |
Gene synonyms/obsolete |
tif225 |
Gene product |
translation initiation
factor (eif-2b subiunit); nucleotidyltransferase; guanine
nucleotide exchange factor |
Entry clone |
Cloned |
ORF length (unspliced) |
2193 |
ORF length (spliced) |
2037 |
Entry clone length |
2193 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
2076T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC8C9.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCATCCAAAGGGCT |
Rev primer name |
SPAC8C9.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTGACCCTTCTTCACTC |
Amino acid length |
678 |
Molecular weight |
76.3 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGYFYQLEI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol |
Microscope used for
observation |
Leica |