Gene name |
SPCC1902.01 |
Gene ID |
37/H01 |
Gene synonyms/obsolete |
gaf1;
SPCC417.01c |
Gene product |
ranSpription factor;
involved in transcriptional activation; zinc finger protein;
zf-GATA type |
Entry clone |
Cloned |
ORF length (unspliced) |
2568 |
ORF length (spliced) |
|
Entry clone length |
2568 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
609T:G / 1682T:C /
2266C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1902.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCTAAAGTTTTCCAA |
Rev primer name |
SPCC1902.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATAACGCTATACCAATCC |
Amino acid length |
855 |
Molecular weight |
91.7 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; cytoplasmic
dots at site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to: nucleus
(intranuclear microtubule bundle?) |
Microscope used for
observation |
Leica |