Gene name |
SPBC3D6.13c |
Gene ID |
37/G11 |
Gene synonyms/obsolete |
|
Gene product |
glycoprotein;
thioredoxin related glycoprotein; thioredoxin domain; similar
to Sp SPAC959.05C and SPCC1840.08C (paralogs) |
Entry clone |
Cloned |
ORF length (unspliced) |
2181 |
ORF length (spliced) |
|
Entry clone length |
2181 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
663T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3D6.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGTCAAACACCTTTGG |
Rev primer name |
SPBC3D6.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAAACTTTCCACTGTTT |
Amino acid length |
726 |
Molecular weight |
81.2 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSTSVSSLSL |
Localization (YFP) |
Golgi |
Comments for localization |
Golgi, especially near
site of septum formation |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |