Gene name |
SPAC2E12.02 |
Gene ID |
37/G06 |
Gene synonyms/obsolete |
hsf1; hsft; hsf |
Gene product |
heat shock induced
tranSpriptional activator; essential; required for growth;
stress response activator |
Entry clone |
Cloned |
ORF length (unspliced) |
2172 |
ORF length (spliced) |
1830 |
Entry clone length |
2172 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2E12.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCAGACTGCATCGAC |
Rev primer name |
SPAC2E12.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCACCAATGCTTGATTTC |
Amino acid length |
609 |
Molecular weight |
66.9 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
595 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
cytosol=nucleus; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus |
Microscope used for
observation |
DeltaVision |