| Gene name |
SPAC1751.01c |
| Gene ID |
37/G01 |
| Gene synonyms/obsolete |
gti1 |
| Gene product |
experimentally
characterised; DeSpription required for gluconate-H+ symport;
anion transport; similar to Sp pac2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2163 |
| ORF length (spliced) |
|
| Entry clone length |
2163 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1659T:C /
2049T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1751.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAACCTGGCAATCT |
| Rev primer name |
SPAC1751.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGACAAGGAGCCGCGTTCT |
| Amino acid length |
720 |
| Molecular weight |
78.7 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol; nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to: nucleus;
nuclear dots |
| Microscope used for
observation |
Leica |